ID: 935458805

View in Genome Browser
Species Human (GRCh38)
Location 2:103302970-103302992
Sequence TTCTGTTTCTTGAGGTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935458800_935458805 22 Left 935458800 2:103302925-103302947 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG No data
935458801_935458805 -8 Left 935458801 2:103302955-103302977 CCGTGCCTGACTGCCTTCTGTTT No data
Right 935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG No data
935458799_935458805 23 Left 935458799 2:103302924-103302946 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935458805 Original CRISPR TTCTGTTTCTTGAGGTAAGA AGG Intergenic
No off target data available for this crispr