ID: 935463542

View in Genome Browser
Species Human (GRCh38)
Location 2:103367474-103367496
Sequence TGTAGACAAAATACCTAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935463539_935463542 6 Left 935463539 2:103367445-103367467 CCAAATGAAACTAAAAATTTTCT No data
Right 935463542 2:103367474-103367496 TGTAGACAAAATACCTAGTTGGG No data
935463536_935463542 29 Left 935463536 2:103367422-103367444 CCCTAATTTTTCTTCCAAATTGT No data
Right 935463542 2:103367474-103367496 TGTAGACAAAATACCTAGTTGGG No data
935463538_935463542 15 Left 935463538 2:103367436-103367458 CCAAATTGTCCAAATGAAACTAA No data
Right 935463542 2:103367474-103367496 TGTAGACAAAATACCTAGTTGGG No data
935463537_935463542 28 Left 935463537 2:103367423-103367445 CCTAATTTTTCTTCCAAATTGTC No data
Right 935463542 2:103367474-103367496 TGTAGACAAAATACCTAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935463542 Original CRISPR TGTAGACAAAATACCTAGTT GGG Intergenic
No off target data available for this crispr