ID: 935466705

View in Genome Browser
Species Human (GRCh38)
Location 2:103406621-103406643
Sequence CCATTCACTCAGTGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935466701_935466705 27 Left 935466701 2:103406571-103406593 CCTTCCTGAGAAGCTCTTGTGAG No data
Right 935466705 2:103406621-103406643 CCATTCACTCAGTGTGACCTTGG No data
935466700_935466705 28 Left 935466700 2:103406570-103406592 CCCTTCCTGAGAAGCTCTTGTGA No data
Right 935466705 2:103406621-103406643 CCATTCACTCAGTGTGACCTTGG No data
935466702_935466705 23 Left 935466702 2:103406575-103406597 CCTGAGAAGCTCTTGTGAGACTT No data
Right 935466705 2:103406621-103406643 CCATTCACTCAGTGTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935466705 Original CRISPR CCATTCACTCAGTGTGACCT TGG Intergenic
No off target data available for this crispr