ID: 935468098

View in Genome Browser
Species Human (GRCh38)
Location 2:103423501-103423523
Sequence ATGCTATTTTTGGGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935468093_935468098 21 Left 935468093 2:103423457-103423479 CCTTCTTTTCTAAATTGTCTTCT No data
Right 935468098 2:103423501-103423523 ATGCTATTTTTGGGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935468098 Original CRISPR ATGCTATTTTTGGGGAAAAA AGG Intergenic
No off target data available for this crispr