ID: 935480517

View in Genome Browser
Species Human (GRCh38)
Location 2:103582458-103582480
Sequence CAAGTTGGGCCCTTTCATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935480517_935480526 29 Left 935480517 2:103582458-103582480 CCTAGATGAAAGGGCCCAACTTG No data
Right 935480526 2:103582510-103582532 ATTGCATAAATTAGGAGGGTAGG No data
935480517_935480525 25 Left 935480517 2:103582458-103582480 CCTAGATGAAAGGGCCCAACTTG No data
Right 935480525 2:103582506-103582528 ATTCATTGCATAAATTAGGAGGG No data
935480517_935480520 -10 Left 935480517 2:103582458-103582480 CCTAGATGAAAGGGCCCAACTTG No data
Right 935480520 2:103582471-103582493 GCCCAACTTGTTGGTCATCAGGG No data
935480517_935480524 24 Left 935480517 2:103582458-103582480 CCTAGATGAAAGGGCCCAACTTG No data
Right 935480524 2:103582505-103582527 GATTCATTGCATAAATTAGGAGG No data
935480517_935480523 21 Left 935480517 2:103582458-103582480 CCTAGATGAAAGGGCCCAACTTG No data
Right 935480523 2:103582502-103582524 TATGATTCATTGCATAAATTAGG No data
935480517_935480527 30 Left 935480517 2:103582458-103582480 CCTAGATGAAAGGGCCCAACTTG No data
Right 935480527 2:103582511-103582533 TTGCATAAATTAGGAGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935480517 Original CRISPR CAAGTTGGGCCCTTTCATCT AGG (reversed) Intergenic
No off target data available for this crispr