ID: 935481052

View in Genome Browser
Species Human (GRCh38)
Location 2:103590477-103590499
Sequence ACCTTTTATGCCATCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935481052_935481053 -10 Left 935481052 2:103590477-103590499 CCTTCAAAGATGGCATAAAAGGT No data
Right 935481053 2:103590490-103590512 CATAAAAGGTATTTCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935481052 Original CRISPR ACCTTTTATGCCATCTTTGA AGG (reversed) Intergenic
No off target data available for this crispr