ID: 935483548

View in Genome Browser
Species Human (GRCh38)
Location 2:103623725-103623747
Sequence AGAGATCTTCACATAGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935483548_935483552 25 Left 935483548 2:103623725-103623747 CCCTCATCTATGTGAAGATCTCT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 935483552 2:103623773-103623795 AATTGCCAGAGACAAGGAAGTGG 0: 1
1: 0
2: 2
3: 28
4: 568
935483548_935483551 19 Left 935483548 2:103623725-103623747 CCCTCATCTATGTGAAGATCTCT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 935483551 2:103623767-103623789 AATGAAAATTGCCAGAGACAAGG 0: 1
1: 1
2: 9
3: 51
4: 476
935483548_935483553 26 Left 935483548 2:103623725-103623747 CCCTCATCTATGTGAAGATCTCT 0: 1
1: 0
2: 2
3: 15
4: 194
Right 935483553 2:103623774-103623796 ATTGCCAGAGACAAGGAAGTGGG 0: 1
1: 0
2: 2
3: 25
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935483548 Original CRISPR AGAGATCTTCACATAGATGA GGG (reversed) Intergenic
901342544 1:8508374-8508396 AGAGTTCTGGAGATAGATGACGG + Intronic
905561436 1:38930295-38930317 AGAGGTCTTCACAGAGCAGACGG - Intronic
906969659 1:50498097-50498119 AGAAATCCTCACATATATGTTGG + Intronic
911099202 1:94080628-94080650 AGAGACCTTTACAAAGCTGATGG - Exonic
913446502 1:118955972-118955994 AGAGATCTTCAAGGAGATTATGG - Intronic
916030213 1:160870281-160870303 AGAGTTCTGCAGATGGATGATGG - Intergenic
916286677 1:163113186-163113208 AGAGATCTTGACAGTGTTGAGGG - Intronic
916782093 1:168044719-168044741 AGAGAGATTAACATAGATTAAGG - Intronic
917519219 1:175734162-175734184 ACATATATTGACATAGATGAGGG + Intronic
918255802 1:182746067-182746089 AGAGGTCTTCAGATATTTGAGGG - Intergenic
918385885 1:184006840-184006862 AGAGATGTTAAGATAGAGGAGGG - Intronic
920461607 1:206144797-206144819 AGAGATCCTGACCTAGGTGAGGG + Intergenic
921218047 1:212953311-212953333 AGAGGTCTTCAGAAAGAGGAGGG - Intronic
923776705 1:236985120-236985142 AGAGAGCTCCACATGGCTGAGGG - Intergenic
923961262 1:239086020-239086042 GAAGATCTTCAAATAGAAGAGGG - Intergenic
924136910 1:240976864-240976886 AGAGATAGACAGATAGATGATGG - Intronic
924163286 1:241256030-241256052 ATAAAACTGCACATAGATGAGGG + Intronic
1063715074 10:8519157-8519179 AGAGACCCACACATAGAAGAAGG + Intergenic
1064570642 10:16689208-16689230 AAATATCTTCACAAAGATGGAGG - Intronic
1068531031 10:58186825-58186847 AGAGAACTTCGCATAGAAAATGG + Intergenic
1073126883 10:101156489-101156511 AGAGCTCTCCCCATAGAGGAGGG - Intergenic
1075647748 10:124107734-124107756 AGAGATCTACACATGGGGGATGG - Intergenic
1076962051 10:133771112-133771134 AGAGATCTTGGCATAGAGAAAGG + Intergenic
1077004111 11:343384-343406 AGGCATCTTCACATAGGTAAGGG - Intergenic
1080389399 11:31830551-31830573 AGACATCATCACATAGGTGGTGG - Intronic
1081233528 11:40617074-40617096 AGATGTCTTCACCTAGATGTGGG - Intronic
1082156097 11:48816229-48816251 AAATATCTTCACATAGAAGCTGG + Intergenic
1082156318 11:48820572-48820594 AAATATCTTCACATAGAAGCTGG + Intergenic
1085715048 11:78864968-78864990 AAGGATCTTCAGAGAGATGAAGG + Intronic
1086162590 11:83739096-83739118 AGAGACATTCACAAAGCTGAAGG + Intronic
1087331226 11:96783141-96783163 AGAGATATTCAAACAGATTAGGG - Intergenic
1087347935 11:96994735-96994757 ATGGATGTTTACATAGATGAAGG + Intergenic
1087542512 11:99538212-99538234 AGAGATCAGGACATAAATGATGG - Intronic
1088176761 11:107061433-107061455 TGAGATATTCACTTAGCTGAAGG - Intergenic
1088312388 11:108473767-108473789 ACAGTTATTAACATAGATGAAGG - Exonic
1088756410 11:112888929-112888951 AGAGATCCCAACATATATGAAGG - Intergenic
1089413131 11:118264136-118264158 AGAGCTCTTGCCATACATGAGGG + Exonic
1090451533 11:126810666-126810688 AGAGGTCTTTACATTGAAGAGGG + Intronic
1095031841 12:37296511-37296533 AAATATCTTCACATAAATAATGG + Intergenic
1096763151 12:53860532-53860554 CCAGATCTTCAGAAAGATGAAGG - Intergenic
1096975963 12:55699381-55699403 GGAAGTCTTCACATGGATGAGGG + Intronic
1097286687 12:57883001-57883023 AGAGAGCTACAGAGAGATGAAGG + Intergenic
1099123348 12:78720328-78720350 AGAGACCATCCCATAGCTGAGGG + Intergenic
1100128087 12:91455206-91455228 AGAGATATTCACATCACTGAAGG + Intergenic
1102123182 12:110459038-110459060 ACAGATCATCACACAGATAATGG - Intronic
1105281862 13:18968950-18968972 AGAAATCTTCAATTACATGAGGG + Intergenic
1105929467 13:25038960-25038982 AGAGTTCTGCAGATAGATGGTGG + Intergenic
1108421625 13:50256261-50256283 AGAGATTTAAACATGGATGAAGG - Intronic
1110011171 13:70335924-70335946 AGAGATCCTCAAATGGATTATGG + Intergenic
1111495484 13:89043867-89043889 TGAGAACTTCACATAGACGGGGG - Intergenic
1112939637 13:104845557-104845579 AGAGGTCTTCCCATACCTGATGG + Intergenic
1113710726 13:112462975-112462997 AGACATCCTCAGATAGGTGAAGG + Intergenic
1114222854 14:20712510-20712532 AGAGATTTTCAACTAGATGATGG - Intergenic
1115055425 14:29120862-29120884 AGAGTGCTTCACAAAGATTATGG + Intergenic
1116187165 14:41611165-41611187 AGAAACCTGAACATAGATGATGG + Intronic
1118014463 14:61644352-61644374 ATAAATTTTCACATAGAGGAAGG - Intronic
1121756483 14:96407107-96407129 AAATATCTGCATATAGATGAAGG + Intronic
1124136707 15:27041932-27041954 AGAGGTCTTCATGCAGATGAAGG + Intronic
1126167274 15:45664377-45664399 AGCCATCTTCAAATAGCTGAAGG - Intronic
1127188267 15:56503731-56503753 AGACTTCATCACAGAGATGAAGG + Intergenic
1127450162 15:59108799-59108821 AGCTTTCTTCACAGAGATGATGG + Intronic
1127746328 15:61979233-61979255 AGGGATCTTCAAAAAGTTGATGG + Intronic
1128696332 15:69765993-69766015 AGAGTTCTGGAGATAGATGATGG - Intergenic
1128711303 15:69874300-69874322 AAAGATCACCACATAGCTGATGG - Intergenic
1132103421 15:99044790-99044812 AAAAATCTCCACATTGATGAGGG - Intergenic
1138256065 16:55562277-55562299 AGAGTTCTCCAAATAGATAAGGG - Intronic
1142557420 17:789170-789192 AGAGAACTTCACATCGATTATGG + Intronic
1143864684 17:9915466-9915488 GGAGGTCTTCACGTAGGTGAAGG + Exonic
1144047141 17:11464363-11464385 AGAGATTTTCACATAGATTCTGG + Intronic
1144382298 17:14713935-14713957 AAAGATCTTCAAGTAAATGATGG + Intergenic
1144826959 17:18110626-18110648 CTAGATTCTCACATAGATGAAGG - Intronic
1147008074 17:37420725-37420747 AGTGATCTTCACTTGGAAGAGGG + Intronic
1150216050 17:63470381-63470403 AGACAGCTTCACATGGAGGAAGG - Intergenic
1155797135 18:30054421-30054443 AGAGATATCCACATAGATAATGG + Intergenic
1156919994 18:42510198-42510220 AGCAATCTTCATATAGCTGAAGG + Intergenic
1156925293 18:42570150-42570172 AAAGAAATTCACTTAGATGATGG + Intergenic
1159979715 18:74763489-74763511 AGAAATCTTTACCTAGATGAAGG + Intronic
1160654553 19:257679-257701 AGAGATCTTGGCATAGAGAAAGG - Intergenic
1164943881 19:32273868-32273890 AGTGATCTTCACAAAGAACATGG + Intergenic
1164986229 19:32650698-32650720 AGAACACTTCACATGGATGATGG + Intronic
1166762082 19:45231315-45231337 AAAGATCTTCACATATAAGCAGG - Intronic
1168438141 19:56338707-56338729 AGAGATGGTCACTTGGATGAGGG + Intronic
1168562989 19:57398737-57398759 GGAGATCTTCACATGCATGGAGG + Exonic
1168727198 19:58591816-58591838 AGAGATCTTGGCATAGAGAAAGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927190664 2:20514787-20514809 ACAGACCTCCGCATAGATGATGG + Intergenic
928504420 2:31935244-31935266 AGAGATCTTTACATGTTTGAAGG + Intronic
928911282 2:36424277-36424299 AGAGATATTCACAGAGGAGAAGG + Intronic
929213100 2:39381356-39381378 AGAGTTCTTCACATATATTCTGG + Intronic
931444921 2:62318694-62318716 ACAGAACTTCAAAAAGATGAGGG + Intergenic
934911766 2:98264422-98264444 AGATATCTTGAGATAAATGAAGG - Intronic
935483548 2:103623725-103623747 AGAGATCTTCACATAGATGAGGG - Intergenic
936571355 2:113619379-113619401 AGAGATCTTGGCATAGAGAAAGG - Intergenic
937028837 2:118721379-118721401 AGAGATTTTCACAAAGAAGTTGG - Intergenic
938971929 2:136440431-136440453 AGAGAGCTCCACAGTGATGATGG + Intergenic
939183859 2:138837654-138837676 AGAGATCTTCTCAGTGAGGAGGG + Intergenic
940338262 2:152551381-152551403 AGAGTTCCTCACATAGATGGTGG - Intronic
941090809 2:161172993-161173015 AGAGATTTTCAAGGAGATGATGG - Intronic
942043167 2:172084425-172084447 AGACGTCTACACATAGATAAGGG + Intergenic
942126225 2:172828353-172828375 ACATATCTTCACACAGAGGAGGG + Intronic
943540022 2:189201542-189201564 AGAGATATTCAAAAAGATAATGG + Intergenic
943712982 2:191118687-191118709 AGAAATTCTCACATAGATAAAGG - Intronic
946133212 2:217623532-217623554 TAAGATATTCACATATATGAAGG + Intronic
946873590 2:224106812-224106834 AGATATCTTAACAAAGGTGAAGG - Intergenic
1168762784 20:360714-360736 AGTGATATTCATATAGATGGGGG + Intergenic
1171398177 20:24853471-24853493 GGAGATGTTCACATAGCTCAAGG - Intergenic
1173684035 20:44910217-44910239 AGAGAACTTCTCATAGAGCATGG - Exonic
1174645663 20:52083469-52083491 AGAGATGTTCAGCTTGATGAGGG + Intronic
1178045785 21:28693272-28693294 AGAGATCTTTACAAAGAAGGTGG + Intergenic
1178367806 21:32002072-32002094 AAAGAACTTCACATAAAAGATGG - Exonic
1178381614 21:32114447-32114469 AAAGATCTTCCCATTGCTGAGGG - Intergenic
1180262640 21:46683618-46683640 AGAGATCTTGGCATAGAGAAAGG + Intergenic
1182053221 22:27329140-27329162 AGAGATTTTTATATAGATCAAGG - Intergenic
1182186758 22:28412157-28412179 ACAGATCTTCAGATATCTGAAGG - Intronic
1185428835 22:50791495-50791517 AGAGATCTTGGCATAGAGAAAGG + Intergenic
950117860 3:10463088-10463110 AGAGAACTTCACAGAGAAGTTGG - Intronic
951433116 3:22631075-22631097 AGAGATATTAAAATAGATCATGG - Intergenic
951849480 3:27122949-27122971 AGAGATCGGCACACGGATGAAGG + Intronic
952854404 3:37756683-37756705 AGAGATCCTAACATAAATAAGGG + Intronic
952885219 3:38007785-38007807 GGAGATCTTCACAAAGAGGGTGG + Exonic
953238859 3:41130217-41130239 AGAGACCTTCATATTGATGTTGG - Intergenic
954649191 3:52149881-52149903 AGAGAAGTTCACACAGGTGACGG + Exonic
958078877 3:88719597-88719619 AGAGTTCTGCAGATGGATGATGG + Intergenic
958959586 3:100496152-100496174 AGAGATCATTTCACAGATGATGG - Intronic
960128720 3:114029404-114029426 ATACATATACACATAGATGAAGG + Intronic
960879499 3:122330384-122330406 AAAGATCATCACATAGAAAAGGG + Intronic
962504984 3:136037635-136037657 CGTGATCCTCACATAGATGAGGG - Intronic
964298892 3:155265500-155265522 AGAGATATTCACACAGGTGCTGG - Intergenic
965341448 3:167496638-167496660 AGAGATCTTGACATTGAAGTGGG - Intronic
966227574 3:177614546-177614568 AGAGACCTTCCCATTGAAGATGG + Intergenic
967389244 3:188939181-188939203 AGAGATCTGAACTTAGATGTGGG - Intergenic
969688677 4:8691228-8691250 CGTGATCTTCACATGGATGCGGG - Intergenic
969688690 4:8691326-8691348 CGTGATCTTCACATGGATGCGGG - Intergenic
971965820 4:33554249-33554271 CTAGAACTTCACAGAGATGAAGG - Intergenic
973845026 4:54902975-54902997 ATAGATCTTCACACAGAGTAGGG - Intergenic
975227011 4:71884733-71884755 AGAGGACTTCTCATAGAAGATGG - Intergenic
977266379 4:94860901-94860923 AGAGATATACACATATATGAAGG - Intronic
977266390 4:94861056-94861078 AGAGATAGACACATATATGAAGG - Intronic
977285702 4:95104012-95104034 AGAGATCTGCACACAGATAATGG - Intronic
978586231 4:110278693-110278715 AGTGATCTTCATGTTGATGAAGG + Intergenic
979807640 4:124994619-124994641 TGAGGTCTTCTCATAGCTGATGG - Intergenic
980410517 4:132412732-132412754 AGAAATCTTCACTTAGATGATGG - Intergenic
980709751 4:136549568-136549590 AGAGAAATTCACATAGATTTGGG - Intergenic
982177872 4:152723466-152723488 AGAGATCTGGAGATAGATGGTGG + Intronic
985465283 4:190188592-190188614 AGAGATCTTGGCATAGAGAAAGG + Intergenic
987217585 5:15753484-15753506 AGAAATTTTCACAATGATGAGGG - Intronic
988421183 5:31008027-31008049 AAAGATCATCAGATAGAGGAAGG + Intergenic
990287331 5:54312461-54312483 AGAGATTTTCACCTAGATTTTGG + Intergenic
993162462 5:84310274-84310296 AGAAATCTTCAGATTAATGAAGG + Intronic
993870615 5:93249772-93249794 TGATATATTCACATAAATGATGG + Intergenic
995302022 5:110595294-110595316 AGATAAATTCACAAAGATGAGGG + Intronic
998575692 5:143313409-143313431 AGAGATTATAATATAGATGAGGG - Intronic
998666070 5:144298774-144298796 AGAGGACTTCAGAGAGATGAAGG - Intronic
1000392587 5:160740543-160740565 AGAGTTCTTCAAATACCTGAAGG + Intronic
1000501820 5:162061432-162061454 AGACATTTTCAAATAAATGAAGG - Intergenic
1000861909 5:166465909-166465931 AGAGATCTTTGCATAGATAAGGG + Intergenic
1001753647 5:174150034-174150056 AGGGATCTTCATTTAGATGATGG - Intronic
1001755992 5:174170179-174170201 AGAGTTTTTCTCAGAGATGAAGG + Intronic
1002167100 5:177354814-177354836 GGAGGTCTTCACAGAGAAGAAGG + Intergenic
1002330146 5:178435369-178435391 AGTGATCTTCACCTATATGTGGG + Intronic
1004463259 6:15858749-15858771 AGAAATGTACACATACATGAAGG - Intergenic
1008708313 6:54191154-54191176 AGATATCTTCACTAAAATGATGG + Intronic
1010610592 6:77950349-77950371 ATACATCTTCACATGGCTGAAGG - Intergenic
1012471061 6:99572579-99572601 AGAGATTTATACAAAGATGAAGG - Intergenic
1014769291 6:125443238-125443260 AGTTATCTTTACATTGATGATGG + Intergenic
1017837915 6:158196467-158196489 AGAGGTCTTCAAAAAGTTGATGG + Exonic
1017990816 6:159488463-159488485 AAAAATCTTCACAAAGATGATGG + Intergenic
1020058722 7:5136381-5136403 AGACCTCTTCACATAGCTTAGGG - Intergenic
1021316227 7:19150706-19150728 AGAGTTCTTGAGATGGATGATGG - Intergenic
1022436994 7:30396751-30396773 GGAGATGATCAGATAGATGAAGG - Intronic
1025520760 7:61726266-61726288 AAATATCTTCACATAGAAAATGG - Intergenic
1025545117 7:62155826-62155848 AAATATCTTCACATAGAAAATGG - Intergenic
1027267250 7:76501186-76501208 AGAGATCTTCAGATACTTGGGGG + Intronic
1027277986 7:76581815-76581837 AAAAATCTTTACATAGTTGAAGG + Intergenic
1027319062 7:77001054-77001076 AGAGATCTTCAGATACTTGGGGG + Intergenic
1029329886 7:99843869-99843891 AGAGCTCTTCAAAGAGATCATGG - Intronic
1031408840 7:121419090-121419112 AGAGCTCTGAACACAGATGAAGG - Intergenic
1033216750 7:139499097-139499119 AGAGATCTTCACAATGATGATGG + Intergenic
1033942346 7:146671256-146671278 ATAGACCTTCACACAGGTGATGG - Intronic
1037114820 8:15211635-15211657 AGAGATGATCACATAGAAGAAGG - Intronic
1037187822 8:16085919-16085941 AGAGATATTCACATAGAACCTGG + Intergenic
1039292866 8:36116318-36116340 AGGGATAGTCACATAGATAATGG - Intergenic
1041400677 8:57441242-57441264 GGAGATCATCACATAATTGAGGG - Intergenic
1044027154 8:87187327-87187349 AGATATTTTCCCATAAATGATGG + Intronic
1047225732 8:122954115-122954137 AGAGATGTTGACACAGATGGTGG + Intronic
1048139852 8:131783706-131783728 AGAGGTCTTCAGAGAGCTGAAGG - Intergenic
1048205658 8:132413278-132413300 AGAAAGCTGCAAATAGATGAAGG - Intronic
1048338153 8:133518331-133518353 AGAGAGCTTCACATGGCTGGTGG - Intronic
1048711215 8:137213134-137213156 GAAGTTCTTCACATAAATGAAGG + Intergenic
1048823529 8:138400930-138400952 AGAGATCTTAAAATGGTTGATGG - Intronic
1050088666 9:1993241-1993263 AAAGATATTTACATCGATGATGG - Intergenic
1051631172 9:19142185-19142207 AGGCATCTTCACAAAAATGAAGG - Intronic
1052107687 9:24539428-24539450 AAAGATTTTCACATTCATGATGG - Intergenic
1055240398 9:74178503-74178525 AATAATCTTCACATAGATAAAGG + Intergenic
1055551993 9:77439916-77439938 AGACATCTCCACTTAGATGCTGG - Intronic
1055917154 9:81416122-81416144 TGAGATTCTCACACAGATGATGG + Intergenic
1059420842 9:114191110-114191132 AGAGAACTTCACCTAGACGGAGG - Intronic
1186004516 X:5053961-5053983 AGATAGCTTCAGATAGATGATGG + Intergenic
1188218091 X:27503640-27503662 AGAGATAGACACATAGATAATGG - Intergenic
1188660823 X:32756632-32756654 ACAGATCTACACATAGATAGAGG + Intronic
1188982380 X:36738629-36738651 AGGGATCTTCACAAAGTTCATGG - Intergenic
1190768684 X:53497282-53497304 AGAGATCTTAACATTAATGCTGG - Intergenic
1193473787 X:81939481-81939503 AGAGCTCTTTACGGAGATGAAGG + Intergenic
1195755572 X:108195725-108195747 GGAGATCTTTAAATAGATTATGG + Intronic
1196112437 X:111961669-111961691 AAAGATCTTCACATATATCCAGG + Intronic
1198778449 X:140206919-140206941 AGCCATCTTCACCTTGATGATGG - Intergenic
1201241502 Y:11961210-11961232 AGAGATCAATAGATAGATGAAGG - Intergenic
1201349201 Y:13020668-13020690 AAAAATGTACACATAGATGAAGG - Intergenic
1201558111 Y:15285953-15285975 AAAGTTCTTTACATAGATGAAGG - Intergenic
1201631238 Y:16073792-16073814 AGAGACCTTGACTTAGATCATGG + Intergenic
1201785508 Y:17773137-17773159 TGATATCTTCTCATAGTTGAAGG - Intergenic
1201816045 Y:18132850-18132872 TGATATCTTCTCATAGTTGAAGG + Intergenic