ID: 935486129

View in Genome Browser
Species Human (GRCh38)
Location 2:103656537-103656559
Sequence CGATAGCTAATTAGGTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935486129_935486133 12 Left 935486129 2:103656537-103656559 CCTATTTACCTAATTAGCTATCG No data
Right 935486133 2:103656572-103656594 TACTACATTTACAAATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935486129 Original CRISPR CGATAGCTAATTAGGTAAAT AGG (reversed) Intergenic
No off target data available for this crispr