ID: 935502303

View in Genome Browser
Species Human (GRCh38)
Location 2:103856539-103856561
Sequence ATGTCTCATGAGGCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935502297_935502303 30 Left 935502297 2:103856486-103856508 CCTTTTTATGGGCACACACACTG No data
Right 935502303 2:103856539-103856561 ATGTCTCATGAGGCTTTTGTGGG No data
935502299_935502303 -1 Left 935502299 2:103856517-103856539 CCATTGCGAACTCAGTCACCAGA No data
Right 935502303 2:103856539-103856561 ATGTCTCATGAGGCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935502303 Original CRISPR ATGTCTCATGAGGCTTTTGT GGG Intergenic
No off target data available for this crispr