ID: 935509455

View in Genome Browser
Species Human (GRCh38)
Location 2:103953048-103953070
Sequence TATTTCATAAAGAAAGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935509455_935509457 2 Left 935509455 2:103953048-103953070 CCTACCACTTTCTTTATGAAATA No data
Right 935509457 2:103953073-103953095 TTATTTATCTTTATTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935509455 Original CRISPR TATTTCATAAAGAAAGTGGT AGG (reversed) Intergenic
No off target data available for this crispr