ID: 935516836

View in Genome Browser
Species Human (GRCh38)
Location 2:104050826-104050848
Sequence ACTAAATTCTGCACTTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935516836_935516839 -9 Left 935516836 2:104050826-104050848 CCTGTATAAGTGCAGAATTTAGT No data
Right 935516839 2:104050840-104050862 GAATTTAGTGTTGGGTCTTAAGG No data
935516836_935516840 1 Left 935516836 2:104050826-104050848 CCTGTATAAGTGCAGAATTTAGT No data
Right 935516840 2:104050850-104050872 TTGGGTCTTAAGGTTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935516836 Original CRISPR ACTAAATTCTGCACTTATAC AGG (reversed) Intergenic
No off target data available for this crispr