ID: 935517273

View in Genome Browser
Species Human (GRCh38)
Location 2:104056287-104056309
Sequence TCTGCTGGTTCTCTCCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935517273_935517274 -10 Left 935517273 2:104056287-104056309 CCAGCATGGAGAGAACCAGCAGA No data
Right 935517274 2:104056300-104056322 AACCAGCAGATACAACAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935517273 Original CRISPR TCTGCTGGTTCTCTCCATGC TGG (reversed) Intergenic
No off target data available for this crispr