ID: 935519626

View in Genome Browser
Species Human (GRCh38)
Location 2:104088416-104088438
Sequence CAATTTCAGCAAAAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935519625_935519626 13 Left 935519625 2:104088380-104088402 CCTTTGTATTTTCATATAAATTT No data
Right 935519626 2:104088416-104088438 CAATTTCAGCAAAAGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935519626 Original CRISPR CAATTTCAGCAAAAGCCATC TGG Intergenic
No off target data available for this crispr