ID: 935528065

View in Genome Browser
Species Human (GRCh38)
Location 2:104197207-104197229
Sequence GCTTGCCTGCTGCTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935528062_935528065 -3 Left 935528062 2:104197187-104197209 CCTGGGGGTGTGTTCCAGTGGCT No data
Right 935528065 2:104197207-104197229 GCTTGCCTGCTGCTGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935528065 Original CRISPR GCTTGCCTGCTGCTGGTCAC AGG Intergenic
No off target data available for this crispr