ID: 935534374

View in Genome Browser
Species Human (GRCh38)
Location 2:104276605-104276627
Sequence AATCTCAGCATCTCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935534373_935534374 -10 Left 935534373 2:104276592-104276614 CCTGAAAATTATCAATCTCAGCA No data
Right 935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG No data
935534372_935534374 4 Left 935534372 2:104276578-104276600 CCAGGGTTTCAACACCTGAAAAT No data
Right 935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935534374 Original CRISPR AATCTCAGCATCTCTAAAAC TGG Intergenic
No off target data available for this crispr