ID: 935538907

View in Genome Browser
Species Human (GRCh38)
Location 2:104326395-104326417
Sequence GGAGCACCAAGAGTCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935538907_935538917 10 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538917 2:104326428-104326450 TGTGGGAGCACCTGATGGTCAGG No data
935538907_935538909 -8 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538909 2:104326410-104326432 GGTGCTCCCTCCCCTCTCTGTGG No data
935538907_935538910 -7 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538910 2:104326411-104326433 GTGCTCCCTCCCCTCTCTGTGGG No data
935538907_935538918 11 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG No data
935538907_935538916 5 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538916 2:104326423-104326445 CTCTCTGTGGGAGCACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935538907 Original CRISPR GGAGCACCAAGAGTCAGCCC GGG (reversed) Intergenic