ID: 935538909

View in Genome Browser
Species Human (GRCh38)
Location 2:104326410-104326432
Sequence GGTGCTCCCTCCCCTCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935538907_935538909 -8 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538909 2:104326410-104326432 GGTGCTCCCTCCCCTCTCTGTGG No data
935538908_935538909 -9 Left 935538908 2:104326396-104326418 CCGGGCTGACTCTTGGTGCTCCC No data
Right 935538909 2:104326410-104326432 GGTGCTCCCTCCCCTCTCTGTGG No data
935538899_935538909 29 Left 935538899 2:104326358-104326380 CCAGTAAGCCCAGGGGAAAGAGT No data
Right 935538909 2:104326410-104326432 GGTGCTCCCTCCCCTCTCTGTGG No data
935538903_935538909 20 Left 935538903 2:104326367-104326389 CCAGGGGAAAGAGTGGAGGAATA No data
Right 935538909 2:104326410-104326432 GGTGCTCCCTCCCCTCTCTGTGG No data
935538902_935538909 21 Left 935538902 2:104326366-104326388 CCCAGGGGAAAGAGTGGAGGAAT No data
Right 935538909 2:104326410-104326432 GGTGCTCCCTCCCCTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935538909 Original CRISPR GGTGCTCCCTCCCCTCTCTG TGG Intergenic