ID: 935538910

View in Genome Browser
Species Human (GRCh38)
Location 2:104326411-104326433
Sequence GTGCTCCCTCCCCTCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935538907_935538910 -7 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538910 2:104326411-104326433 GTGCTCCCTCCCCTCTCTGTGGG No data
935538902_935538910 22 Left 935538902 2:104326366-104326388 CCCAGGGGAAAGAGTGGAGGAAT No data
Right 935538910 2:104326411-104326433 GTGCTCCCTCCCCTCTCTGTGGG No data
935538908_935538910 -8 Left 935538908 2:104326396-104326418 CCGGGCTGACTCTTGGTGCTCCC No data
Right 935538910 2:104326411-104326433 GTGCTCCCTCCCCTCTCTGTGGG No data
935538903_935538910 21 Left 935538903 2:104326367-104326389 CCAGGGGAAAGAGTGGAGGAATA No data
Right 935538910 2:104326411-104326433 GTGCTCCCTCCCCTCTCTGTGGG No data
935538899_935538910 30 Left 935538899 2:104326358-104326380 CCAGTAAGCCCAGGGGAAAGAGT No data
Right 935538910 2:104326411-104326433 GTGCTCCCTCCCCTCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935538910 Original CRISPR GTGCTCCCTCCCCTCTCTGT GGG Intergenic