ID: 935538911

View in Genome Browser
Species Human (GRCh38)
Location 2:104326416-104326438
Sequence GTGCTCCCACAGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935538911_935538918 -10 Left 935538911 2:104326416-104326438 CCCTCCCCTCTCTGTGGGAGCAC No data
Right 935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG No data
935538911_935538924 24 Left 935538911 2:104326416-104326438 CCCTCCCCTCTCTGTGGGAGCAC No data
Right 935538924 2:104326463-104326485 GCCCACACAGACCAGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935538911 Original CRISPR GTGCTCCCACAGAGAGGGGA GGG (reversed) Intergenic