ID: 935538916

View in Genome Browser
Species Human (GRCh38)
Location 2:104326423-104326445
Sequence CTCTCTGTGGGAGCACCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935538908_935538916 4 Left 935538908 2:104326396-104326418 CCGGGCTGACTCTTGGTGCTCCC No data
Right 935538916 2:104326423-104326445 CTCTCTGTGGGAGCACCTGATGG No data
935538907_935538916 5 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538916 2:104326423-104326445 CTCTCTGTGGGAGCACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935538916 Original CRISPR CTCTCTGTGGGAGCACCTGA TGG Intergenic