ID: 935538918

View in Genome Browser
Species Human (GRCh38)
Location 2:104326429-104326451
Sequence GTGGGAGCACCTGATGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935538907_935538918 11 Left 935538907 2:104326395-104326417 CCCGGGCTGACTCTTGGTGCTCC No data
Right 935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG No data
935538908_935538918 10 Left 935538908 2:104326396-104326418 CCGGGCTGACTCTTGGTGCTCCC No data
Right 935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG No data
935538911_935538918 -10 Left 935538911 2:104326416-104326438 CCCTCCCCTCTCTGTGGGAGCAC No data
Right 935538918 2:104326429-104326451 GTGGGAGCACCTGATGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935538918 Original CRISPR GTGGGAGCACCTGATGGTCA GGG Intergenic