ID: 935539064

View in Genome Browser
Species Human (GRCh38)
Location 2:104327910-104327932
Sequence ATGTAGCCACAACCTCGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935539060_935539064 -3 Left 935539060 2:104327890-104327912 CCACCCACATACATGACACCATG No data
Right 935539064 2:104327910-104327932 ATGTAGCCACAACCTCGCACTGG No data
935539061_935539064 -6 Left 935539061 2:104327893-104327915 CCCACATACATGACACCATGTAG No data
Right 935539064 2:104327910-104327932 ATGTAGCCACAACCTCGCACTGG No data
935539062_935539064 -7 Left 935539062 2:104327894-104327916 CCACATACATGACACCATGTAGC No data
Right 935539064 2:104327910-104327932 ATGTAGCCACAACCTCGCACTGG No data
935539058_935539064 3 Left 935539058 2:104327884-104327906 CCTCCTCCACCCACATACATGAC No data
Right 935539064 2:104327910-104327932 ATGTAGCCACAACCTCGCACTGG No data
935539059_935539064 0 Left 935539059 2:104327887-104327909 CCTCCACCCACATACATGACACC No data
Right 935539064 2:104327910-104327932 ATGTAGCCACAACCTCGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935539064 Original CRISPR ATGTAGCCACAACCTCGCAC TGG Intergenic
No off target data available for this crispr