ID: 935540067

View in Genome Browser
Species Human (GRCh38)
Location 2:104338288-104338310
Sequence GTCTGCAGCCTCAGCGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935540067_935540073 -1 Left 935540067 2:104338288-104338310 CCTTCCCCGCTGAGGCTGCAGAC No data
Right 935540073 2:104338310-104338332 CATCCAAAAGGGCAGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935540067 Original CRISPR GTCTGCAGCCTCAGCGGGGA AGG (reversed) Intergenic
No off target data available for this crispr