ID: 935543813

View in Genome Browser
Species Human (GRCh38)
Location 2:104379223-104379245
Sequence AATACAAAAGCAAGTCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935543813_935543814 1 Left 935543813 2:104379223-104379245 CCTCTGTGACTTGCTTTTGTATT No data
Right 935543814 2:104379247-104379269 GATACCCATGATAAACCATCTGG No data
935543813_935543815 2 Left 935543813 2:104379223-104379245 CCTCTGTGACTTGCTTTTGTATT No data
Right 935543815 2:104379248-104379270 ATACCCATGATAAACCATCTGGG No data
935543813_935543819 20 Left 935543813 2:104379223-104379245 CCTCTGTGACTTGCTTTTGTATT No data
Right 935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935543813 Original CRISPR AATACAAAAGCAAGTCACAG AGG (reversed) Intergenic
No off target data available for this crispr