ID: 935543814

View in Genome Browser
Species Human (GRCh38)
Location 2:104379247-104379269
Sequence GATACCCATGATAAACCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935543813_935543814 1 Left 935543813 2:104379223-104379245 CCTCTGTGACTTGCTTTTGTATT No data
Right 935543814 2:104379247-104379269 GATACCCATGATAAACCATCTGG No data
935543811_935543814 25 Left 935543811 2:104379199-104379221 CCCTTGTTTTCAGATCTTCTAAT No data
Right 935543814 2:104379247-104379269 GATACCCATGATAAACCATCTGG No data
935543812_935543814 24 Left 935543812 2:104379200-104379222 CCTTGTTTTCAGATCTTCTAATA No data
Right 935543814 2:104379247-104379269 GATACCCATGATAAACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935543814 Original CRISPR GATACCCATGATAAACCATC TGG Intergenic