ID: 935543815

View in Genome Browser
Species Human (GRCh38)
Location 2:104379248-104379270
Sequence ATACCCATGATAAACCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935543812_935543815 25 Left 935543812 2:104379200-104379222 CCTTGTTTTCAGATCTTCTAATA No data
Right 935543815 2:104379248-104379270 ATACCCATGATAAACCATCTGGG No data
935543811_935543815 26 Left 935543811 2:104379199-104379221 CCCTTGTTTTCAGATCTTCTAAT No data
Right 935543815 2:104379248-104379270 ATACCCATGATAAACCATCTGGG No data
935543813_935543815 2 Left 935543813 2:104379223-104379245 CCTCTGTGACTTGCTTTTGTATT No data
Right 935543815 2:104379248-104379270 ATACCCATGATAAACCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935543815 Original CRISPR ATACCCATGATAAACCATCT GGG Intergenic