ID: 935543816

View in Genome Browser
Species Human (GRCh38)
Location 2:104379251-104379273
Sequence GTGCCCAGATGGTTTATCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935543816_935543819 -8 Left 935543816 2:104379251-104379273 CCCATGATAAACCATCTGGGCAC No data
Right 935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935543816 Original CRISPR GTGCCCAGATGGTTTATCAT GGG (reversed) Intergenic