ID: 935543817

View in Genome Browser
Species Human (GRCh38)
Location 2:104379252-104379274
Sequence CGTGCCCAGATGGTTTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935543817_935543819 -9 Left 935543817 2:104379252-104379274 CCATGATAAACCATCTGGGCACG No data
Right 935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935543817 Original CRISPR CGTGCCCAGATGGTTTATCA TGG (reversed) Intergenic
No off target data available for this crispr