ID: 935543819

View in Genome Browser
Species Human (GRCh38)
Location 2:104379266-104379288
Sequence CTGGGCACGAGCTGTCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935543813_935543819 20 Left 935543813 2:104379223-104379245 CCTCTGTGACTTGCTTTTGTATT No data
Right 935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG No data
935543816_935543819 -8 Left 935543816 2:104379251-104379273 CCCATGATAAACCATCTGGGCAC No data
Right 935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG No data
935543817_935543819 -9 Left 935543817 2:104379252-104379274 CCATGATAAACCATCTGGGCACG No data
Right 935543819 2:104379266-104379288 CTGGGCACGAGCTGTCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935543819 Original CRISPR CTGGGCACGAGCTGTCTTCC AGG Intergenic
No off target data available for this crispr