ID: 935545275

View in Genome Browser
Species Human (GRCh38)
Location 2:104394614-104394636
Sequence TGGATTTATACCCGTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935545275_935545280 1 Left 935545275 2:104394614-104394636 CCAAGCACACGGGTATAAATCCA No data
Right 935545280 2:104394638-104394660 AGGCCAGGTGAAGGCCTAAGTGG No data
935545275_935545283 13 Left 935545275 2:104394614-104394636 CCAAGCACACGGGTATAAATCCA No data
Right 935545283 2:104394650-104394672 GGCCTAAGTGGTAAGGTACATGG No data
935545275_935545282 6 Left 935545275 2:104394614-104394636 CCAAGCACACGGGTATAAATCCA No data
Right 935545282 2:104394643-104394665 AGGTGAAGGCCTAAGTGGTAAGG No data
935545275_935545284 14 Left 935545275 2:104394614-104394636 CCAAGCACACGGGTATAAATCCA No data
Right 935545284 2:104394651-104394673 GCCTAAGTGGTAAGGTACATGGG No data
935545275_935545278 -8 Left 935545275 2:104394614-104394636 CCAAGCACACGGGTATAAATCCA No data
Right 935545278 2:104394629-104394651 TAAATCCACAGGCCAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935545275 Original CRISPR TGGATTTATACCCGTGTGCT TGG (reversed) Intergenic
No off target data available for this crispr