ID: 935553569

View in Genome Browser
Species Human (GRCh38)
Location 2:104483263-104483285
Sequence GAGGCATGACCTGATTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935553569_935553573 14 Left 935553569 2:104483263-104483285 CCTGGGGAATCAGGTCATGCCTC No data
Right 935553573 2:104483300-104483322 TTTGAGCTTCAGGTATTCTGTGG No data
935553569_935553572 4 Left 935553569 2:104483263-104483285 CCTGGGGAATCAGGTCATGCCTC No data
Right 935553572 2:104483290-104483312 GAGTGTGATATTTGAGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935553569 Original CRISPR GAGGCATGACCTGATTCCCC AGG (reversed) Intergenic
No off target data available for this crispr