ID: 935554687

View in Genome Browser
Species Human (GRCh38)
Location 2:104496323-104496345
Sequence CCCATGGCAATACCATCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935554681_935554687 -6 Left 935554681 2:104496306-104496328 CCCCTCATTCCACTCAGCCCATG No data
Right 935554687 2:104496323-104496345 CCCATGGCAATACCATCAAGTGG No data
935554680_935554687 -5 Left 935554680 2:104496305-104496327 CCCCCTCATTCCACTCAGCCCAT No data
Right 935554687 2:104496323-104496345 CCCATGGCAATACCATCAAGTGG No data
935554682_935554687 -7 Left 935554682 2:104496307-104496329 CCCTCATTCCACTCAGCCCATGG No data
Right 935554687 2:104496323-104496345 CCCATGGCAATACCATCAAGTGG No data
935554684_935554687 -8 Left 935554684 2:104496308-104496330 CCTCATTCCACTCAGCCCATGGC No data
Right 935554687 2:104496323-104496345 CCCATGGCAATACCATCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935554687 Original CRISPR CCCATGGCAATACCATCAAG TGG Intergenic
No off target data available for this crispr