ID: 935554720

View in Genome Browser
Species Human (GRCh38)
Location 2:104496762-104496784
Sequence AAATAGACACAGATAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935554720_935554723 -9 Left 935554720 2:104496762-104496784 CCCTTCTCTATCTGTGTCTATTT No data
Right 935554723 2:104496776-104496798 TGTCTATTTTGGTGCCTTATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935554720 Original CRISPR AAATAGACACAGATAGAGAA GGG (reversed) Intergenic
No off target data available for this crispr