ID: 935562002

View in Genome Browser
Species Human (GRCh38)
Location 2:104568961-104568983
Sequence TTCGTTCTGGCTTTTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935562002_935562011 24 Left 935562002 2:104568961-104568983 CCTGACCCAAAAGCCAGAACGAA No data
Right 935562011 2:104569008-104569030 ATCCAGGATCATTGCAACAGGGG No data
935562002_935562007 -7 Left 935562002 2:104568961-104568983 CCTGACCCAAAAGCCAGAACGAA No data
Right 935562007 2:104568977-104568999 GAACGAAGTTAAAGTGGTGAAGG No data
935562002_935562009 22 Left 935562002 2:104568961-104568983 CCTGACCCAAAAGCCAGAACGAA No data
Right 935562009 2:104569006-104569028 TTATCCAGGATCATTGCAACAGG No data
935562002_935562010 23 Left 935562002 2:104568961-104568983 CCTGACCCAAAAGCCAGAACGAA No data
Right 935562010 2:104569007-104569029 TATCCAGGATCATTGCAACAGGG No data
935562002_935562008 8 Left 935562002 2:104568961-104568983 CCTGACCCAAAAGCCAGAACGAA No data
Right 935562008 2:104568992-104569014 GGTGAAGGCAAATGTTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935562002 Original CRISPR TTCGTTCTGGCTTTTGGGTC AGG (reversed) Intergenic
No off target data available for this crispr