ID: 935562564

View in Genome Browser
Species Human (GRCh38)
Location 2:104574275-104574297
Sequence ATGGATAAGTAGAAAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935562563_935562564 -9 Left 935562563 2:104574261-104574283 CCTGGAGCATTGGAATGGATAAG No data
Right 935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG No data
935562560_935562564 -3 Left 935562560 2:104574255-104574277 CCTCACCCTGGAGCATTGGAATG No data
Right 935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG No data
935562562_935562564 -8 Left 935562562 2:104574260-104574282 CCCTGGAGCATTGGAATGGATAA No data
Right 935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG No data
935562557_935562564 18 Left 935562557 2:104574234-104574256 CCTCTTAAATGACAAGATTGGCC No data
Right 935562564 2:104574275-104574297 ATGGATAAGTAGAAAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935562564 Original CRISPR ATGGATAAGTAGAAAGTGCA TGG Intergenic
No off target data available for this crispr