ID: 935563447

View in Genome Browser
Species Human (GRCh38)
Location 2:104582105-104582127
Sequence TAGAGACACCAGCTACAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935563442_935563447 24 Left 935563442 2:104582058-104582080 CCTTAAAGTTAATATCAAATTAA No data
Right 935563447 2:104582105-104582127 TAGAGACACCAGCTACAAACTGG No data
935563444_935563447 -8 Left 935563444 2:104582090-104582112 CCTCCCTGATTTCTTTAGAGACA No data
Right 935563447 2:104582105-104582127 TAGAGACACCAGCTACAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935563447 Original CRISPR TAGAGACACCAGCTACAAAC TGG Intergenic
No off target data available for this crispr