ID: 935568546

View in Genome Browser
Species Human (GRCh38)
Location 2:104635149-104635171
Sequence CATGCTGGTCCTTCTGCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935568538_935568546 16 Left 935568538 2:104635110-104635132 CCTATCAGGGTGACAGAGCCCCA No data
Right 935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG No data
935568539_935568546 -2 Left 935568539 2:104635128-104635150 CCCCAGCACTCTGCCTGTGCACA No data
Right 935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG No data
935568540_935568546 -3 Left 935568540 2:104635129-104635151 CCCAGCACTCTGCCTGTGCACAT No data
Right 935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG No data
935568541_935568546 -4 Left 935568541 2:104635130-104635152 CCAGCACTCTGCCTGTGCACATG No data
Right 935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935568546 Original CRISPR CATGCTGGTCCTTCTGCCTG GGG Intergenic
No off target data available for this crispr