ID: 935568916

View in Genome Browser
Species Human (GRCh38)
Location 2:104638525-104638547
Sequence ACAGCTCTAAATGGTCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935568914_935568916 -8 Left 935568914 2:104638510-104638532 CCTTTTTTAAATTGCACAGCTCT No data
Right 935568916 2:104638525-104638547 ACAGCTCTAAATGGTCTTTAAGG No data
935568910_935568916 30 Left 935568910 2:104638472-104638494 CCGCAGTCAGTAGCCTAAGCAGG No data
Right 935568916 2:104638525-104638547 ACAGCTCTAAATGGTCTTTAAGG No data
935568913_935568916 17 Left 935568913 2:104638485-104638507 CCTAAGCAGGTATTAATAAAGGT No data
Right 935568916 2:104638525-104638547 ACAGCTCTAAATGGTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935568916 Original CRISPR ACAGCTCTAAATGGTCTTTA AGG Intergenic
No off target data available for this crispr