ID: 935573571

View in Genome Browser
Species Human (GRCh38)
Location 2:104687298-104687320
Sequence CCTGATCCCCAGTGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935573557_935573571 22 Left 935573557 2:104687253-104687275 CCACCCTCCACCACATGTTGACT No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data
935573558_935573571 19 Left 935573558 2:104687256-104687278 CCCTCCACCACATGTTGACTGAG No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data
935573556_935573571 28 Left 935573556 2:104687247-104687269 CCACTGCCACCCTCCACCACATG No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data
935573562_935573571 -9 Left 935573562 2:104687284-104687306 CCACCGTTCTGCCCCCTGATCCC No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data
935573559_935573571 18 Left 935573559 2:104687257-104687279 CCTCCACCACATGTTGACTGAGA No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data
935573561_935573571 12 Left 935573561 2:104687263-104687285 CCACATGTTGACTGAGAGAGACC No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data
935573560_935573571 15 Left 935573560 2:104687260-104687282 CCACCACATGTTGACTGAGAGAG No data
Right 935573571 2:104687298-104687320 CCTGATCCCCAGTGGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935573571 Original CRISPR CCTGATCCCCAGTGGGGACC TGG Intergenic
No off target data available for this crispr