ID: 935577430

View in Genome Browser
Species Human (GRCh38)
Location 2:104725389-104725411
Sequence GGTTCTGGATGGTCAACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935577430_935577435 29 Left 935577430 2:104725389-104725411 CCCTGAGTTGACCATCCAGAACC No data
Right 935577435 2:104725441-104725463 GTTGCATGTGCCCAGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935577430 Original CRISPR GGTTCTGGATGGTCAACTCA GGG (reversed) Intergenic
No off target data available for this crispr