ID: 935578582

View in Genome Browser
Species Human (GRCh38)
Location 2:104736124-104736146
Sequence GATGTCTGCAGGGATCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935578582_935578588 23 Left 935578582 2:104736124-104736146 CCACCTGGATCCCTGCAGACATC No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935578582 Original CRISPR GATGTCTGCAGGGATCCAGG TGG (reversed) Intergenic
No off target data available for this crispr