ID: 935578588

View in Genome Browser
Species Human (GRCh38)
Location 2:104736170-104736192
Sequence CCACAATGCCTGTCCTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935578586_935578588 -3 Left 935578586 2:104736150-104736172 CCTACAGCGTGCTTCTCAGACCA No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578582_935578588 23 Left 935578582 2:104736124-104736146 CCACCTGGATCCCTGCAGACATC No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578580_935578588 25 Left 935578580 2:104736122-104736144 CCCCACCTGGATCCCTGCAGACA No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578585_935578588 12 Left 935578585 2:104736135-104736157 CCTGCAGACATCTCACCTACAGC No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578581_935578588 24 Left 935578581 2:104736123-104736145 CCCACCTGGATCCCTGCAGACAT No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578583_935578588 20 Left 935578583 2:104736127-104736149 CCTGGATCCCTGCAGACATCTCA No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578584_935578588 13 Left 935578584 2:104736134-104736156 CCCTGCAGACATCTCACCTACAG No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data
935578579_935578588 29 Left 935578579 2:104736118-104736140 CCTTCCCCACCTGGATCCCTGCA No data
Right 935578588 2:104736170-104736192 CCACAATGCCTGTCCTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935578588 Original CRISPR CCACAATGCCTGTCCTCCTC AGG Intergenic
No off target data available for this crispr