ID: 935580347

View in Genome Browser
Species Human (GRCh38)
Location 2:104750739-104750761
Sequence CAGGGTGAAGACAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935580347_935580359 16 Left 935580347 2:104750739-104750761 CCCACCTCCCTGTCTTCACCCTG No data
Right 935580359 2:104750778-104750800 TACTTCAGATATTGGCCAAATGG No data
935580347_935580356 8 Left 935580347 2:104750739-104750761 CCCACCTCCCTGTCTTCACCCTG No data
Right 935580356 2:104750770-104750792 ACGCCCGTTACTTCAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935580347 Original CRISPR CAGGGTGAAGACAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr