ID: 935582287

View in Genome Browser
Species Human (GRCh38)
Location 2:104766986-104767008
Sequence CCAGTTAACCAGTTCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935582282_935582287 9 Left 935582282 2:104766954-104766976 CCTGCACGTCACTCAACAGCCCT No data
Right 935582287 2:104766986-104767008 CCAGTTAACCAGTTCTCAGTTGG No data
935582283_935582287 -10 Left 935582283 2:104766973-104766995 CCCTGCCTGCTAACCAGTTAACC No data
Right 935582287 2:104766986-104767008 CCAGTTAACCAGTTCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935582287 Original CRISPR CCAGTTAACCAGTTCTCAGT TGG Intergenic
No off target data available for this crispr