ID: 935588800

View in Genome Browser
Species Human (GRCh38)
Location 2:104826081-104826103
Sequence CACCACCCAGAGCTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935588793_935588800 -2 Left 935588793 2:104826060-104826082 CCTCCACCCCACAAACTCTACCA No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588786_935588800 17 Left 935588786 2:104826041-104826063 CCATCTGTGCCCACCCTCCCCTC No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588787_935588800 8 Left 935588787 2:104826050-104826072 CCCACCCTCCCCTCCACCCCACA No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588796_935588800 -9 Left 935588796 2:104826067-104826089 CCCACAAACTCTACCACCACCCA No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588795_935588800 -8 Left 935588795 2:104826066-104826088 CCCCACAAACTCTACCACCACCC No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588788_935588800 7 Left 935588788 2:104826051-104826073 CCACCCTCCCCTCCACCCCACAA 0: 2
1: 77
2: 163
3: 636
4: 2864
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588797_935588800 -10 Left 935588797 2:104826068-104826090 CCACAAACTCTACCACCACCCAG No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588794_935588800 -5 Left 935588794 2:104826063-104826085 CCACCCCACAAACTCTACCACCA No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588785_935588800 18 Left 935588785 2:104826040-104826062 CCCATCTGTGCCCACCCTCCCCT No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588792_935588800 -1 Left 935588792 2:104826059-104826081 CCCTCCACCCCACAAACTCTACC No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588790_935588800 3 Left 935588790 2:104826055-104826077 CCTCCCCTCCACCCCACAAACTC No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588791_935588800 0 Left 935588791 2:104826058-104826080 CCCCTCCACCCCACAAACTCTAC No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data
935588789_935588800 4 Left 935588789 2:104826054-104826076 CCCTCCCCTCCACCCCACAAACT No data
Right 935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935588800 Original CRISPR CACCACCCAGAGCTGTAGCT GGG Intergenic
No off target data available for this crispr