ID: 935589900

View in Genome Browser
Species Human (GRCh38)
Location 2:104836541-104836563
Sequence CCACATAAGGAGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935589889_935589900 6 Left 935589889 2:104836512-104836534 CCTTAACTTGCACAGCGGCTTCC No data
Right 935589900 2:104836541-104836563 CCACATAAGGAGCTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935589900 Original CRISPR CCACATAAGGAGCTGGAGCT GGG Intergenic
No off target data available for this crispr