ID: 935589933

View in Genome Browser
Species Human (GRCh38)
Location 2:104836741-104836763
Sequence GGTCTAAGAGCCTCACAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935589926_935589933 13 Left 935589926 2:104836705-104836727 CCACTGATGTTACTACAAAAGTG No data
Right 935589933 2:104836741-104836763 GGTCTAAGAGCCTCACAAGTGGG No data
935589925_935589933 19 Left 935589925 2:104836699-104836721 CCTTGTCCACTGATGTTACTACA No data
Right 935589933 2:104836741-104836763 GGTCTAAGAGCCTCACAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935589933 Original CRISPR GGTCTAAGAGCCTCACAAGT GGG Intergenic
No off target data available for this crispr