ID: 935590188

View in Genome Browser
Species Human (GRCh38)
Location 2:104841072-104841094
Sequence GTAAATATACATATGCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935590188_935590190 27 Left 935590188 2:104841072-104841094 CCCTTGTGCATATGTATATTTAC No data
Right 935590190 2:104841122-104841144 ACCAAACTGTACTATACTTAAGG No data
935590188_935590192 30 Left 935590188 2:104841072-104841094 CCCTTGTGCATATGTATATTTAC No data
Right 935590192 2:104841125-104841147 AAACTGTACTATACTTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935590188 Original CRISPR GTAAATATACATATGCACAA GGG (reversed) Intergenic
No off target data available for this crispr