ID: 935590805

View in Genome Browser
Species Human (GRCh38)
Location 2:104844378-104844400
Sequence AGGGTCCTTCTCTTGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935590805_935590811 30 Left 935590805 2:104844378-104844400 CCCTCTCCCAAGAGAAGGACCCT No data
Right 935590811 2:104844431-104844453 TTGCAATCTGCCCACACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935590805 Original CRISPR AGGGTCCTTCTCTTGGGAGA GGG (reversed) Intergenic
No off target data available for this crispr