ID: 935593574

View in Genome Browser
Species Human (GRCh38)
Location 2:104862892-104862914
Sequence TTGATCTGTAATTGAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935593574_935593577 28 Left 935593574 2:104862892-104862914 CCTGCCTTTCAATTACAGATCAA 0: 1
1: 0
2: 0
3: 17
4: 152
Right 935593577 2:104862943-104862965 TCTATCTTCCTAAAAAGCGATGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935593574 Original CRISPR TTGATCTGTAATTGAAAGGC AGG (reversed) Intergenic
903095989 1:20974142-20974164 TTGATCTGTATTTGAAGATCTGG - Intronic
906612665 1:47214117-47214139 GTGATCTGGAATAGAAAGGATGG + Intergenic
907177366 1:52537548-52537570 TTGTTCTGTTATTGAAAAGTGGG - Intronic
908482103 1:64551375-64551397 TTGATCTGTGCTTGAAAAGAAGG + Intronic
910620923 1:89253751-89253773 TTGATCTGTAATTTGAAGTTAGG - Intergenic
911341206 1:96640872-96640894 TTAATCTTTAATTTACAGGCAGG - Intergenic
913117120 1:115707472-115707494 TTTATCTGTCATTGCAGGGCTGG + Intronic
916830871 1:168489589-168489611 TTGAAATGTATTTGATAGGCTGG + Intergenic
917493507 1:175518815-175518837 TGGACCTGTAATTGAAAAGCTGG - Intronic
918029234 1:180787741-180787763 CTCATCTGTAACTGAAAGACAGG - Exonic
920460809 1:206138586-206138608 TTGATTTGGACCTGAAAGGCAGG - Intergenic
921932419 1:220765502-220765524 TTGAACACTCATTGAAAGGCAGG + Intronic
923370445 1:233306328-233306350 TTGATCCATTATTGAAAGTCAGG - Intergenic
923784174 1:237051658-237051680 TTGATATGTAATTGTCTGGCAGG + Intronic
924249855 1:242121463-242121485 TTGAATTGAAATTCAAAGGCAGG + Intronic
1064882584 10:20072623-20072645 CTGATCTGTCAGTGGAAGGCAGG + Intronic
1066801535 10:39198020-39198042 GTGATCTGTGATTTAAGGGCAGG - Intergenic
1067251353 10:44589494-44589516 ATTATTTTTAATTGAAAGGCAGG - Intergenic
1068484834 10:57644662-57644684 CTGATCTGTAAATAAATGGCAGG + Intergenic
1069389443 10:67917802-67917824 TTGATCTCTAGTTTTAAGGCAGG - Exonic
1070509741 10:77149723-77149745 CTGATCTGAATTTGAATGGCAGG + Intronic
1070600227 10:77860993-77861015 TTGTTTTGTAATGGAAAGGGTGG - Intronic
1072942575 10:99780023-99780045 CTGAACTGTAATTGAATTGCCGG - Intergenic
1074169190 10:110916642-110916664 TTCATCTGTATTTGAATTGCAGG + Intronic
1074258759 10:111830736-111830758 TTGATCTGAAACAGAAAGTCAGG + Intergenic
1080698572 11:34624402-34624424 TTGCTCTATAACTGAAAGGAGGG + Intronic
1085814380 11:79721087-79721109 TTGATATGTTATTGAAATGTTGG - Intergenic
1086284837 11:85235383-85235405 TTAATGTGTAAATGAAAGGATGG - Intronic
1086949873 11:92880847-92880869 TTCATCTGCAATTGTAAAGCTGG + Exonic
1087530350 11:99373415-99373437 TTCATTTGAAATTAAAAGGCCGG + Intronic
1088437166 11:109827287-109827309 TTAATCTGTGACTGAAAGGTTGG + Intergenic
1089946035 11:122474686-122474708 TTGGTGTCTGATTGAAAGGCTGG - Intergenic
1091482419 12:847197-847219 TTGATCTGTAATTCACAAGGCGG + Intronic
1092692777 12:11132497-11132519 TTTTTCTTTAATTGAAAAGCTGG + Intronic
1095206823 12:39447818-39447840 TTAATCTGTAAGTCAAAGGTAGG - Intergenic
1099158001 12:79203646-79203668 TTTATCTTAAATTGAAAGGAAGG + Intronic
1104512095 12:129390258-129390280 ATGATCTGTAAATGGAAGGGTGG - Intronic
1106427961 13:29651215-29651237 TTTATCTGTTATTGAAAAGTGGG + Intergenic
1107705616 13:43100830-43100852 TTGTTCTGTTATTGAAAGTGGGG + Intronic
1107728279 13:43321930-43321952 CTAATCTGTAATTAAAAGGCTGG - Intronic
1108634088 13:52315352-52315374 TTGAAAAGTAATTGGAAGGCTGG - Intergenic
1109384863 13:61614454-61614476 TTGATAATTAATTGAAAGGTAGG - Intergenic
1109985354 13:69975769-69975791 TTGAGGTGTCATTGAATGGCCGG + Exonic
1110309303 13:74029304-74029326 TTTATCTGTTGTTGAAATGCAGG + Intronic
1110882786 13:80593494-80593516 TGGATCTGTAATTCAAACTCAGG + Intergenic
1115567664 14:34638618-34638640 ATGATCTAAAATTAAAAGGCAGG - Intergenic
1117301611 14:54435170-54435192 CTGGTCAGTAATTGAAAGGTTGG - Intronic
1123485601 15:20734811-20734833 TTTATGTGTAAGTGAAATGCAGG - Intergenic
1123542086 15:21303862-21303884 TTTATGTGTAAGTGAAATGCAGG - Intergenic
1124480428 15:30074664-30074686 TTGATTTGTGTATGAAAGGCAGG - Intergenic
1125461043 15:39907075-39907097 TTGAGCTGCAATTTAAAGGATGG + Intronic
1126635942 15:50779963-50779985 TTGAACATTAATTGAAAGGAAGG + Intergenic
1126973897 15:54151698-54151720 TTGATCTGGAATGTAAATGCTGG - Intronic
1128282804 15:66410541-66410563 TTGATATATAATCCAAAGGCAGG + Intronic
1202950404 15_KI270727v1_random:31002-31024 TTTATGTGTAAGTGAAATGCAGG - Intergenic
1133294201 16:4742864-4742886 TCAATCTGTAATGGAAAGGCGGG + Intronic
1136302061 16:29341966-29341988 TTGTTCTGTAAGACAAAGGCAGG - Intergenic
1137750508 16:50858071-50858093 TTGATCTGTCCTTCAAAGCCTGG - Intergenic
1138135976 16:54523107-54523129 TTGATATTTAATTCAAAGGCAGG - Intergenic
1141965637 16:87440914-87440936 TTCATCTGAAAATGAAGGGCAGG - Intronic
1147524912 17:41213252-41213274 TTGATCAATAACTGCAAGGCTGG - Intronic
1149384509 17:56128289-56128311 TTGATATGCAATGGAAAGACGGG + Intronic
1149536881 17:57440121-57440143 TTGAACTGTGCTTGAAAGGGTGG + Intronic
1157229871 18:45905670-45905692 TTGATCTGTAATTCAAGCTCAGG - Intronic
1158114627 18:53981121-53981143 TGGATCTGGAGTTCAAAGGCAGG + Intergenic
1164947590 19:32309562-32309584 CTGATCTGTAAATGAAAGTAAGG - Intergenic
1166074213 19:40404360-40404382 TTGAGTTGTGATTGAGAGGCGGG + Intronic
1168551404 19:57299127-57299149 TTGATCATTTCTTGAAAGGCTGG + Intergenic
925417005 2:3677383-3677405 CTGATGAGTAATGGAAAGGCTGG + Intronic
929879456 2:45823438-45823460 TTAATCTGTCAGTGAATGGCAGG - Intronic
932040290 2:68292388-68292410 TAGAACTGAATTTGAAAGGCTGG - Intronic
932877084 2:75463977-75463999 TAGATCTGTAAGTGAGAAGCTGG - Intergenic
934658292 2:96129141-96129163 TAAATCTGTTATTGAAAGGAAGG - Intronic
935075307 2:99736904-99736926 TAAATCAGTAATTTAAAGGCCGG - Intronic
935455953 2:103268171-103268193 TTGATCTGGAATTTAAAGGATGG + Intergenic
935593574 2:104862892-104862914 TTGATCTGTAATTGAAAGGCAGG - Intergenic
935774337 2:106458884-106458906 TTAAACTGTAATTGTAAGGCAGG - Intronic
935905731 2:107837029-107837051 TTAAACTGTAATTGTAAGGCAGG + Intronic
935992212 2:108729558-108729580 TTAAACCGTAATTGTAAGGCAGG + Intronic
936127527 2:109802210-109802232 TTAAACTGTAATTGTAAGGCAGG + Intronic
936217170 2:110569275-110569297 TTAAACTGTAATTGTAAGGCAGG - Intronic
936255571 2:110907777-110907799 TTTATTTGTAATTGAAAGAAGGG - Intronic
936426310 2:112423858-112423880 CTAAACTGTAATTGTAAGGCAGG - Intronic
940489432 2:154338822-154338844 TTGCTTTGCATTTGAAAGGCAGG + Intronic
940513052 2:154643254-154643276 TTGATTTTTAAGTCAAAGGCAGG + Intergenic
940818481 2:158324347-158324369 TTGCTATGTAATTAAAAAGCAGG - Intronic
944224493 2:197336337-197336359 TTGAACTGTAATTGGAACTCAGG + Intergenic
945120984 2:206456612-206456634 TTGATCTGTAATTATATAGCTGG + Intronic
946848713 2:223884423-223884445 TTGTCCTGTATTGGAAAGGCAGG - Intronic
1169697490 20:8407265-8407287 GTTATCTGTGATTTAAAGGCTGG - Intronic
1170048851 20:12117362-12117384 TTGGTCTGTTATTGAAAGTGGGG - Intergenic
1170263998 20:14444629-14444651 TGGGTCTGAAATTGAAAGGAGGG - Intronic
1174911638 20:54614522-54614544 TTGTTTTGTACTTGAAAGGCGGG + Intronic
1177840858 21:26232251-26232273 TTGATGTGTAAAAGAATGGCTGG + Intergenic
1178077680 21:29026869-29026891 TTGAGGTGTAATAGAAAGTCAGG + Intronic
1178892251 21:36530047-36530069 TTAATCTTTAACTGAAAGGAAGG - Intronic
1183023453 22:35045885-35045907 TTGAGCTGGAATTCAAACGCAGG + Intergenic
949946815 3:9196107-9196129 TTGATTTGGAAATGAAAGCCAGG + Intronic
950617815 3:14176328-14176350 TTGATCTGTGATTTAAAGGATGG - Intronic
959904993 3:111701545-111701567 TTGAGCTTTATTTGGAAGGCGGG + Intronic
965519110 3:169655227-169655249 TTGTTCTGAAATACAAAGGCTGG + Intronic
966226647 3:177605067-177605089 TTGAGCTGGCATTAAAAGGCAGG - Intergenic
974423949 4:61716196-61716218 TTCTTCTGTTATTGAAAGACTGG + Intronic
975060196 4:69987389-69987411 TTCATTTGTATGTGAAAGGCAGG - Intergenic
975254937 4:72222977-72222999 CTAATCTGTATTTGAAAGTCTGG - Intergenic
977683870 4:99825466-99825488 TTGATCTGTGAGTTAAAGGCAGG - Intronic
978204497 4:106064103-106064125 TTGATCTGTAGATGATAGGTTGG - Intronic
979451260 4:120873442-120873464 TTGAATTTTAATTGAAAAGCAGG - Intronic
980634061 4:135474809-135474831 TAAATCTGTACTTGAAATGCAGG - Intergenic
980643794 4:135615723-135615745 TAGATATGTAATTCCAAGGCAGG - Intergenic
981886600 4:149681916-149681938 TTTATCTGAAATTGAGAGACTGG - Intergenic
983251172 4:165348043-165348065 TTGAAGTGAAATTGAAATGCTGG + Intergenic
983459475 4:168010107-168010129 TTGAACTCTAATTGAAAGAGGGG + Intergenic
992480016 5:77141569-77141591 TTGTTCTGGAATTTAAAGACAGG + Intergenic
993424380 5:87744451-87744473 TTGATCTGTATTTGAAAACTAGG + Intergenic
994057413 5:95433990-95434012 TTGATGTGTAATCCAAGGGCTGG - Intronic
994675470 5:102815754-102815776 TTGAACTGTTGTTGAAAGACTGG + Intronic
995413972 5:111888788-111888810 TTGAGCTGTATTTCAAATGCTGG + Intronic
997695210 5:135856200-135856222 TTTCTGTGTAATGGAAAGGCTGG + Intronic
997834711 5:137182865-137182887 GTGACCTGGAACTGAAAGGCAGG - Intronic
998113136 5:139517375-139517397 TTGATCTTTATATGAAAGGAAGG + Intergenic
999602301 5:153280769-153280791 ATGAACTGTAATTGAAATTCAGG - Intergenic
1002783666 6:385154-385176 CTGAGCTGTAGTTGAAAGGTGGG + Intergenic
1002839074 6:890274-890296 TTGCTCTGTAAGTGAAGTGCCGG - Intergenic
1004701755 6:18086187-18086209 TTGATCTGAAGTTGGAAAGCTGG - Intergenic
1007025334 6:38565831-38565853 TTGTTCTGTAATTGCAAAACTGG + Intronic
1008838348 6:55866231-55866253 TTTCTCTGTGATTGAAGGGCAGG + Intronic
1013917617 6:115361125-115361147 TTGAACTGTATTTGAAACACAGG + Intergenic
1014420430 6:121237050-121237072 TTCATCATTATTTGAAAGGCAGG + Intronic
1017088953 6:150741694-150741716 TTGAGCTGGAACTGAAAAGCAGG + Intronic
1019825811 7:3283306-3283328 TTGAGCTGGAATTTAAAGGGTGG + Intergenic
1020332642 7:7035839-7035861 TAGGTCTGTAAGTGCAAGGCTGG + Intergenic
1020517127 7:9136889-9136911 TTTATCTTTAATGGAAAGGCAGG - Intergenic
1021232018 7:18096754-18096776 TTGCTCTGTGACTCAAAGGCAGG + Intronic
1021682543 7:23148975-23148997 ATGATCTGAAAAAGAAAGGCTGG - Intronic
1022354604 7:29600986-29601008 TTGAGTTGGACTTGAAAGGCTGG + Intergenic
1024801938 7:53089466-53089488 TTGATCTCTAATAAATAGGCAGG + Intergenic
1030340425 7:108373481-108373503 TGGATCTGAAATTGAAAGTAAGG - Intronic
1033728598 7:144148620-144148642 TTCAGCTGTTATTGTAAGGCAGG - Intergenic
1035928116 8:3751759-3751781 TGTATCTGTAATTGAAAGAAAGG - Intronic
1036057963 8:5280935-5280957 TTGATTTGGAACAGAAAGGCAGG - Intergenic
1037385861 8:18340620-18340642 TTGATCTTTTATTGAAAGTGGGG - Intergenic
1037492066 8:19406041-19406063 TTGATCTGGACATCAAAGGCTGG - Exonic
1041196421 8:55406274-55406296 CTGATATGGAATGGAAAGGCTGG - Intronic
1041258360 8:55998878-55998900 TTAATTTGTAATTAAAAGGCTGG - Intronic
1042378102 8:68079271-68079293 TTGATCTTTGGTTGAAAGACTGG - Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1045370733 8:101520018-101520040 TTGATCTAAAATTAAAATGCTGG - Intronic
1048206138 8:132416867-132416889 CTGAACTGAAACTGAAAGGCAGG + Intronic
1050348564 9:4717669-4717691 TTGTACTGAAATTGAAAAGCAGG - Intronic
1050526144 9:6548582-6548604 GTGATCTTTAATTTAATGGCTGG - Intronic
1052154975 9:25175305-25175327 ATGAACTGTAATTGGAGGGCTGG + Intergenic
1053469498 9:38336131-38336153 TTGGTCTGTATGCGAAAGGCAGG - Intergenic
1053696835 9:40647366-40647388 TTGCTTTGATATTGAAAGGCAGG + Intergenic
1054308086 9:63446599-63446621 TTGCTTTGATATTGAAAGGCAGG + Intergenic
1054406819 9:64770590-64770612 TTGCTTTGATATTGAAAGGCAGG + Intergenic
1054440444 9:65256056-65256078 TTGCTTTGATATTGAAAGGCAGG + Intergenic
1054489963 9:65765868-65765890 TTGCTTTGATATTGAAAGGCAGG - Intergenic
1055718762 9:79148011-79148033 TTGAACTGAAATTTAAAGGATGG - Intergenic
1055826448 9:80331103-80331125 TTGAACTGTAATTGAATTGCTGG + Intergenic
1056267375 9:84912321-84912343 TTTATCAATTATTGAAAGGCAGG + Intronic
1061785937 9:133028535-133028557 TTGTATTGTAATTGGAAGGCTGG - Intergenic
1202779287 9_KI270717v1_random:21025-21047 TTGCTTTGATATTGAAAGGCAGG + Intergenic
1186504237 X:10077605-10077627 TTGATCTGAGAATCAAAGGCTGG - Intronic
1187177993 X:16914114-16914136 ATGATCTGTTCTAGAAAGGCAGG + Intergenic
1187192156 X:17045317-17045339 TTAATCTCTTATTCAAAGGCAGG - Intronic
1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG + Intronic
1193770040 X:85577532-85577554 ATGATCTGTGATTGAAAGCCAGG + Intergenic
1196262466 X:113599781-113599803 TTGATCTGTTATTGAAAGTAAGG - Intergenic
1197043330 X:121966976-121966998 TTGCCCTGTAATTTAAAGGAAGG - Intergenic